Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing agaB gene

Properties
Regulog: ScrR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Phylum: Firmicutes
Built upon 24 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Pediococcus pentosaceus ATCC 25745
Position: -193
Score: 6.47461
Sequence: TATGTCAATCGTTTGACATT
Position: -104
Score: 6.06215
Sequence: TGTATCAAACGCTTGACATA
Locus tag: PEPE_0518
Name: scrA
Funciton: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
Locus tag: PEPE_0517
Name: agaB
Funciton: Alpha-galactosidase (EC 3.2.1.22)
Locus tag: PEPE_0516
Name: scrK
Funciton: Fructokinase (EC 2.7.1.4)
scrA-agaB-scrK -193 6.5 TATGTCAATCGTTTGACATT PEPE_0518
-104 6.1 TGTATCAAACGCTTGACATA