Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing scrA gene

Properties
Regulog: ScrR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Phylum: Firmicutes
Built upon 24 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus acidophilus NCFM
Position: -174
Score: 6.08229
Sequence: TGTGTCAAACGTTTATCATA
Position: -86
Score: 6.51618
Sequence: TGTGTCAAACGATTGACATA
Locus tag: LBA0401
Name: scrA
Funciton: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
scrA -174 6.1 TGTGTCAAACGTTTATCATA LBA0401
-86 6.5 TGTGTCAAACGATTGACATA
Lactobacillus fermentum IFO 3956
Position: -106
Score: 5.94762
Sequence: TATGTCAAACGGTTGACAAT
Locus tag: LAF_1578
Name: scrA
Funciton: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
scrA -106 5.9 TATGTCAAACGGTTGACAAT LAF_1578
Lactobacillus johnsonii NCC 533
Position: -168
Score: 5.74614
Sequence: TATGTCAAACGAATAACAGT
Position: -91
Score: 6.09441
Sequence: TATGATAAGCGCTTGACATA
Locus tag: LJ0519
Name: scrA
Funciton: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
scrA -168 5.7 TATGTCAAACGAATAACAGT LJ0519
-91 6.1 TATGATAAGCGCTTGACATA
Lactobacillus plantarum WCFS1
Position: -193
Score: 6.47461
Sequence: TATGTCAATCGTTTGACATT
Position: -104
Score: 6.06215
Sequence: TGTATCAAACGCTTGACATA
Locus tag: lp_0185
Name: scrA
Funciton: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
Locus tag: lp_0184
Name: scrK
Funciton: Fructokinase (EC 2.7.1.4)
scrA-scrK -193 6.5 TATGTCAATCGTTTGACATT lp_0185
-104 6.1 TGTATCAAACGCTTGACATA
Lactobacillus sakei subsp. sakei 23K
Position: -169
Score: 6.05288
Sequence: TATGTCAAACGTATGTCATT
Position: -101
Score: 6.27721
Sequence: TATGATAATCGTTTGACATA
Locus tag: LSA1792
Name: scrA
Funciton: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
scrA -169 6.1 TATGTCAAACGTATGTCATT LSA1792
-101 6.3 TATGATAATCGTTTGACATA
Lactobacillus salivarius subsp. salivarius UCC118
Position: -107
Score: 6.19044
Sequence: TGTGATAAACGATTGACATA
Locus tag: LSL_0066
Name: scrA
Funciton: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
scrA -107 6.2 TGTGATAAACGATTGACATA LSL_0066
Pediococcus pentosaceus ATCC 25745
Position: -193
Score: 6.47461
Sequence: TATGTCAATCGTTTGACATT
Position: -104
Score: 6.06215
Sequence: TGTATCAAACGCTTGACATA
Locus tag: PEPE_0518
Name: scrA
Funciton: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
Locus tag: PEPE_0517
Name: agaB
Funciton: Alpha-galactosidase (EC 3.2.1.22)
Locus tag: PEPE_0516
Name: scrK
Funciton: Fructokinase (EC 2.7.1.4)
scrA-agaB-scrK -193 6.5 TATGTCAATCGTTTGACATT PEPE_0518
-104 6.1 TGTATCAAACGCTTGACATA