Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing dnaK gene

Properties
Regulog: HrcA - Chloroflexia
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Chloroflexi
Built upon 16 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chloroflexus aggregans DSM 9485
Position: -55
Score: 7.59523
Sequence: TTAGCACTCTCGCCTCACGAGTGCTAA
Locus tag: Cagg_2696
Name: hrcA
Funciton: Heat-inducible transcription repressor HrcA
Locus tag: Cagg_2695
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: Cagg_2694
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: Cagg_2693
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ -55 7.6 TTAGCACTCTCGCCTCACGAGTGCTAA Cagg_2696
Chloroflexus sp. Y-400-fl
Position: -55
Score: 7.43587
Sequence: TTAGCACTCTCACCTCACGAGTGCTAA
Locus tag: Chy400_2238
Name: hrcA
Funciton: Heat-inducible transcription repressor HrcA
Locus tag: Chy400_2237
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: Chy400_2236
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: Chy400_2235
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ -55 7.4 TTAGCACTCTCACCTCACGAGTGCTAA Chy400_2238
Herpetosiphon aurantiacus ATCC 23779
Position: -40
Score: 7.325
Sequence: TTAGCACTCCTCGGCCAAGAGTGCTAA
Locus tag: Haur_0438
Name: hrcA
Funciton: Heat-inducible transcription repressor HrcA
Locus tag: Haur_0439
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: Haur_0440
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: Haur_0441
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ -40 7.3 TTAGCACTCCTCGGCCAAGAGTGCTAA Haur_0438
Roseiflexus castenholzii DSM 13941
Position: -102
Score: 7.22691
Sequence: CTAGCACTCACCGGTCGAGAGTGCTAA
Locus tag: Rcas_4390
Name: hrcA
Funciton: Heat-inducible transcription repressor HrcA
Locus tag: Rcas_4391
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: Rcas_4392
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: Rcas_4393
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ -102 7.2 CTAGCACTCACCGGTCGAGAGTGCTAA Rcas_4390
Roseiflexus sp. RS-1
Position: -190
Score: 7.07536
Sequence: CTAGCACTCAATAGTCGAGAGTGCTAA
Locus tag: RoseRS_3462
Name: hrcA
Funciton: Heat-inducible transcription repressor HrcA
Locus tag: RoseRS_3461
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: RoseRS_3460
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: RoseRS_3459
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA-grpE-dnaK-dnaJ -190 7.1 CTAGCACTCAATAGTCGAGAGTGCTAA RoseRS_3462