Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing groEL gene

Properties
Regulog: HrcA - Chloroflexia
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Chloroflexi
Built upon 16 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chloroflexus aggregans DSM 9485
Position: -154
Score: 6.00135
Sequence: TTAGCACTCAGTTTCGACGAGTGCTAA
Position: -81
Score: 7.56762
Sequence: TTAGCACTCTTGAGTTAACAGTGCTAA
Locus tag: Cagg_0489
Name: groES
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Cagg_0488
Name: groEL
Funciton: Heat shock protein 60 family chaperone GroEL
groES-groEL -154 6 TTAGCACTCAGTTTCGACGAGTGCTAA Cagg_0489
-81 7.6 TTAGCACTCTTGAGTTAACAGTGCTAA
Chloroflexus sp. Y-400-fl
Position: -156
Score: 6.01522
Sequence: CTAGCAATCTCTAACGTCGAGTGCTAA
Position: -83
Score: 7.36886
Sequence: TTAGCACTCTCGACGTGACAGTGCTAA
Locus tag: Chy400_2961
Name: groES
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Chy400_2960
Name: groEL
Funciton: Heat shock protein 60 family chaperone GroEL
groES-groEL -156 6 CTAGCAATCTCTAACGTCGAGTGCTAA Chy400_2961
-83 7.4 TTAGCACTCTCGACGTGACAGTGCTAA
Herpetosiphon aurantiacus ATCC 23779
Position: -231
Score: 6.15139
Sequence: TTAGCACTCTCGCCACGATTTTGCTAA
Position: -129
Score: 7.17832
Sequence: TTAGCACTCTCAACCCAAGAGTGATAA
Position: -54
Score: 6.75625
Sequence: TTAGCACTCATCACAGTAGATTGCTAA
Locus tag: Haur_3678
Name: groES
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Haur_3679
Name: groEL
Funciton: Heat shock protein 60 family chaperone GroEL
groES-groEL -231 6.2 TTAGCACTCTCGCCACGATTTTGCTAA Haur_3678
-129 7.2 TTAGCACTCTCAACCCAAGAGTGATAA
-54 6.8 TTAGCACTCATCACAGTAGATTGCTAA
Roseiflexus castenholzii DSM 13941
Position: -145
Score: 6.35457
Sequence: CTGGCACTCTCATCTGGCGAGTGCTAA
Position: -72
Score: 7.67377
Sequence: TTAGCACTCTTTGGTCAAGAGTGCTAA
Locus tag: Rcas_1212
Name: groES
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: Rcas_1211
Name: groEL
Funciton: Heat shock protein 60 family chaperone GroEL
groES-groEL -145 6.4 CTGGCACTCTCATCTGGCGAGTGCTAA Rcas_1212
-72 7.7 TTAGCACTCTTTGGTCAAGAGTGCTAA
Roseiflexus sp. RS-1
Position: -148
Score: 6.41072
Sequence: CTGGCACTCTTCCCTTTTGAGTGCTAA
Position: -75
Score: 7.75523
Sequence: TTAGCACTCTTCCGTCGAGAGTGCTAA
Locus tag: RoseRS_4130
Name: groES
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: RoseRS_4131
Name: groEL
Funciton: Heat shock protein 60 family chaperone GroEL
groES-groEL -148 6.4 CTGGCACTCTTCCCTTTTGAGTGCTAA RoseRS_4130
-75 7.8 TTAGCACTCTTCCGTCGAGAGTGCTAA