Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing chiA gene

Properties
Regulog: GamR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucosamine utilization
Effector: Glucosamine-6-phosphate
Phylum: Firmicutes
Built upon 25 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus clausii KSM-K16
Position: -60
Score: 4.76597
Sequence: GAATTAGTAGTAACAACTTT
Locus tag: ABC0646
Name: chiA
Funciton: Chitinase (EC 3.2.1.14)
chiA -60 4.8 GAATTAGTAGTAACAACTTT ABC0646
Bacillus halodurans C-125
Position: -92
Score: 5.64757
Sequence: ATATTTGTTATTACATTTAT
Position: -68
Score: 4.73071
Sequence: ATTTTAGTAGTAACTTTTAT
Position: -44
Score: 5.2011
Sequence: AATATTGTTACTACAAATAA
Locus tag: BH0916
Name: chiA
Funciton: Chitinase (EC 3.2.1.14)
chiA -92 5.6 ATATTTGTTATTACATTTAT BH0916
-68 4.7 ATTTTAGTAGTAACTTTTAT
-44 5.2 AATATTGTTACTACAAATAA
Bacillus licheniformis DSM 13
Position: -300
Score: 6.21442
Sequence: AAATTTGTCATAACAAATTT
Locus tag: BLi00338
Name: chiA
Funciton: Chitinase (EC 3.2.1.14)
chiA -300 6.2 AAATTTGTCATAACAAATTT BLi00338