Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing gamA gene

Properties
Regulog: GamR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucosamine utilization
Effector: Glucosamine-6-phosphate
Phylum: Firmicutes
Built upon 25 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus subtilis subsp. subtilis str. 168
Position: -75
Score: 5.01924
Sequence: AAATTCGTAATGACAAGTAT
Position: -52
Score: 5.91674
Sequence: AAATTGGTCATAACAAATAT
Locus tag: BSU02360
Name: gamA
Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Locus tag: BSU02350
Name: gamP
Funciton: PTS system, Glucosamine-specific IIB component (EC 2.7.1.69) / PTS system, Glucosamine-specific IIC component (EC 2.7.1.69) / PTS system, Glucosamine-specific IIA component (EC 2.7.1.69)
gamA-gamP -75 5 AAATTCGTAATGACAAGTAT BSU02360
-52 5.9 AAATTGGTCATAACAAATAT