Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing ywbB gene

Regulog: GamR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucosamine utilization
Effector: Glucosamine-6-phosphate
Phylum: Firmicutes
Built upon 25 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus clausii KSM-K16
Position: -97
Score: 5.24467
Position: -73
Score: 5.6533
Locus tag: ABC0643
Name: licH
Funciton: Cytoplasmic 6-phospho-beta-glucosidase (EC
Locus tag: ABC0642
Name: ywbA
Funciton: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIC component (EC
Locus tag: ABC0641
Name: ywbB
Funciton: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIA component (EC
Locus tag: ABC0640
Name: ywbC
Funciton: PTS system, predicted predicted N-acetylglucosamine oligosaccharide-specific IIB component (EC
licH-ywbA-ywbB-ywbC -97 5.2 AAATAGGTAGTTACAAATTT ABC0643
Bacillus halodurans C-125
Position: -74
Score: 5.55165
Locus tag: BH0912
Name: licH
Funciton: Cytoplasmic 6-phospho-beta-glucosidase (EC
Locus tag: BH0911
Name: ywbA
Funciton: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIC component (EC
Locus tag: BH0910
Name: ywbB
Funciton: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIA component (EC
Locus tag: BH0909
Name: ywbC
Funciton: PTS system, predicted predicted N-acetylglucosamine oligosaccharide-specific IIB component (EC
licH-ywbA-ywbB-ywbC -74 5.6 TGATTAGTAGTAACAAATAT BH0912
Bacillus licheniformis DSM 13
Position: -99
Score: 6.23247
Position: -85
Score: 4.5882
Position: -71
Score: 5.19774
Locus tag: BLi00335
Name: licH
Funciton: Cytoplasmic 6-phospho-beta-glucosidase (EC
Locus tag: BLi00334
Name: ywbA
Funciton: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIC component (EC
Locus tag: BLi00333
Name: ywbB
Funciton: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIA component (EC
Locus tag: BLi00332
Name: ywbC
Funciton: PTS system, predicted predicted N-acetylglucosamine oligosaccharide-specific IIB component (EC
licH-ywbA-ywbB-ywbC -99 6.2 CAATTTGTTATAACAAATAT BLi00335
Oceanobacillus iheyensis HTE831
Position: -126
Score: 5.75644
Locus tag: OB2273
Name: licH
Funciton: Cytoplasmic 6-phospho-beta-glucosidase (EC
Locus tag: OB2274
Name: ywbA
Funciton: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIC component (EC
Locus tag: OB2275
Name: ywbB
Funciton: PTS system, predicted N-acetylglucosamine oligosaccharide-specific IIA component (EC
Locus tag: OB2276
Name: ywbC
Funciton: PTS system, predicted predicted N-acetylglucosamine oligosaccharide-specific IIB component (EC
licH-ywbA-ywbB-ywbC -126 5.8 AATTGTGTTATAACAAATTT OB2273