Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing BH0913 gene

Properties
Regulog: GamR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucosamine utilization
Effector: Glucosamine-6-phosphate
Phylum: Firmicutes
Built upon 25 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus clausii KSM-K16
Position: -124
Score: 5.6533
Sequence: ATATTTGTAATTACTAATCA
Position: -100
Score: 5.24467
Sequence: AAATTTGTAACTACCTATTT
Locus tag: ABC0644
Name: null
Funciton: Predicted chitooligosaccharide deacetylase
ABC0644 -124 5.7 ATATTTGTAATTACTAATCA ABC0644
-100 5.2 AAATTTGTAACTACCTATTT
Bacillus halodurans C-125
Position: -116
Score: 5.55165
Sequence: ATATTTGTTACTACTAATCA
Position: -92
Score: 4.79076
Sequence: TTAATTGTAGTTACTTATTT
Position: -60
Score: 4.55935
Sequence: TTATACGTAATGACAATTTT
Locus tag: BH0913
Name: BH0913
Funciton: Predicted chitooligosaccharide deacetylase
BH0913 -116 5.6 ATATTTGTTACTACTAATCA BH0913
-92 4.8 TTAATTGTAGTTACTTATTT
-60 4.6 TTATACGTAATGACAATTTT
Bacillus licheniformis DSM 13
Position: -110
Score: 5.19774
Sequence: TAACATGTTATAACAAATTT
Position: -96
Score: 4.5882
Sequence: AAATTTGTCCATACATATTT
Position: -82
Score: 6.23247
Sequence: ATATTTGTTATAACAAATTG
Locus tag: BLi00336
Name: gamR
Funciton: Predicted transcriptional regulator of glucosamine utilization, GntR family
Locus tag: BLi00337
Name: null
Funciton: Predicted chitooligosaccharide deacetylase
gamR-BLi00337 -110 5.2 TAACATGTTATAACAAATTT BLi00336
-96 4.6 AAATTTGTCCATACATATTT
-82 6.2 ATATTTGTTATAACAAATTG
Oceanobacillus iheyensis HTE831
Position: -81
Score: 5.75644
Sequence: AAATTTGTTATAACACAATT
Locus tag: OB2272
Name: gamR
Funciton: Predicted transcriptional regulator of glucosamine utilization, GntR family
Locus tag: OB2271
Name: null
Funciton: Predicted chitooligosaccharide deacetylase
gamR-OB2271 -81 5.8 AAATTTGTTATAACACAATT OB2272