Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing gamR gene

Properties
Regulog: GamR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucosamine utilization
Effector: Glucosamine-6-phosphate
Phylum: Firmicutes
Built upon 25 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus licheniformis DSM 13
Position: -110
Score: 5.19774
Sequence: TAACATGTTATAACAAATTT
Position: -96
Score: 4.5882
Sequence: AAATTTGTCCATACATATTT
Position: -82
Score: 6.23247
Sequence: ATATTTGTTATAACAAATTG
Locus tag: BLi00336
Name: gamR
Funciton: Predicted transcriptional regulator of glucosamine utilization, GntR family
Locus tag: BLi00337
Name: null
Funciton: Predicted chitooligosaccharide deacetylase
gamR-BLi00337 -110 5.2 TAACATGTTATAACAAATTT BLi00336
-96 4.6 AAATTTGTCCATACATATTT
-82 6.2 ATATTTGTTATAACAAATTG
Bacillus subtilis subsp. subtilis str. 168
Position: -186
Score: 5.91674
Sequence: ATATTTGTTATGACCAATTT
Position: -163
Score: 5.01924
Sequence: ATACTTGTCATTACGAATTT
Locus tag: BSU02370
Name: gamR
Funciton: Predicted transcriptional regulator of glucosamine utilization, GntR family
gamR -186 5.9 ATATTTGTTATGACCAATTT BSU02370
-163 5 ATACTTGTCATTACGAATTT
Oceanobacillus iheyensis HTE831
Position: -81
Score: 5.75644
Sequence: AAATTTGTTATAACACAATT
Locus tag: OB2272
Name: gamR
Funciton: Predicted transcriptional regulator of glucosamine utilization, GntR family
Locus tag: OB2271
Name: null
Funciton: Predicted chitooligosaccharide deacetylase
gamR-OB2271 -81 5.8 AAATTTGTTATAACACAATT OB2272