Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing phnR gene

Properties
Regulog: PhnR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector: 2-aminoethylphosphonate
Phylum: Proteobacteria/gamma
Built upon 6 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -153
Score: 5.8309
Sequence: CATTTGGTCTATACCAGATT
Locus tag: KPN_04062
Name: phnR
Funciton: 2-aminoethylphosphonate utilization regulator, GntR family
phnR -153 5.8 CATTTGGTCTATACCAGATT KPN_04062
Salmonella typhimurium LT2
Position: -131
Score: 5.29201
Sequence: CCTTTGGTCTATACCAGATT
Locus tag: STM0430
Name: phnR
Funciton: 2-aminoethylphosphonate utilization regulator, GntR family
phnR -131 5.3 CCTTTGGTCTATACCAGATT STM0430