Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing phnU gene

Regulog: PhnR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector: 2-aminoethylphosphonate
Phylum: Proteobacteria/gamma
Built upon 6 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -45
Score: 6.21525
Locus tag: KPN_04061
Name: phnS
Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
Locus tag: KPN_04060
Name: phnT
Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
Locus tag: KPN_04059
Name: phnU
Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
Locus tag: KPN_04058
Name: phnV
Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
phnS-phnT-phnU-phnV -45 6.2 AATCTGGTCTACACCAGAAT KPN_04061
Salmonella typhimurium LT2
Position: -48
Score: 6.02449
Locus tag: STM0429
Name: phnS
Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
Locus tag: STM0428
Name: phnT
Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
Locus tag: STM0427
Name: phnU
Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
Locus tag: STM0426
Name: phnV
Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
phnS-phnT-phnU-phnV -48 6 AACCTGGTATAGGCCAGAAA STM0429