Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing phnX gene

Properties
Regulog: PhnR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector: 2-aminoethylphosphonate
Phylum: Proteobacteria/gamma
Built upon 6 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -29
Score: 6.52049
Sequence: AATCTGGTATAGACCAAATG
Locus tag: KPN_04063
Name: phnW
Funciton: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
Locus tag: KPN_04064
Name: phnX
Funciton: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
phnW-phnX -29 6.5 AATCTGGTATAGACCAAATG KPN_04063
Salmonella typhimurium LT2
Position: -28
Score: 6.24367
Sequence: AATCTGGTATAGACCAAAGG
Locus tag: STM0431
Name: phnW
Funciton: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
Locus tag: STM0432
Name: phnX
Funciton: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
phnW-phnX -28 6.2 AATCTGGTATAGACCAAAGG STM0431