Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing fadD2 gene

Properties
Regulog: PsrA - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/beta
Built upon 34 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chromobacterium violaceum ATCC 12472
Position: -18
Score: 5.18422
Sequence: ATTAAAACCATCGTTTGCAT
Locus tag: CV4051
Name: fadD
Funciton: Probable long chain fatty-acid CoA ligase
fadD -18 5.2 ATTAAAACCATCGTTTGCAT CV4051