Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing fabF gene

Properties
Regulog: PsrA - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/beta
Built upon 34 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chromobacterium violaceum ATCC 12472
Position: -91
Score: 5.61093
Sequence: TTCCAAACGCGCGTTTGAAC
Locus tag: CV3412
Name: fabF
Funciton: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
fabF -91 5.6 TTCCAAACGCGCGTTTGAAC CV3412
Laribacter hongkongensis HLHK9
Position: -90
Score: 5.37905
Sequence: AGGCAAACGCCCGTTTGACA
Locus tag: LHK_00568
Name: fabF
Funciton: 3-oxoacyl-[acyl-carrier-protein] synthase, KASII (EC 2.3.1.41)
fabF -90 5.4 AGGCAAACGCCCGTTTGACA LHK_00568