Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing CV3117 gene

Properties
Regulog: PsrA - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/beta
Built upon 34 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Laribacter hongkongensis HLHK9
Position: -88
Score: 5.81484
Sequence: GTTCAAACGATCGTTTTATT
Locus tag: LHK_02384
Name: null
Funciton: probable acyl-CoA-binding protein
LHK_02384 -88 5.8 GTTCAAACGATCGTTTTATT LHK_02384