Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing etfD gene

Properties
Regulog: PsrA - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/beta
Built upon 34 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chromobacterium violaceum ATCC 12472
Position: -108
Score: 5.65568
Sequence: GTTTAAACGCTTGTTTGATT
Locus tag: CV3916
Name: etfD
Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
etfD -108 5.7 GTTTAAACGCTTGTTTGATT CV3916
Laribacter hongkongensis HLHK9
Position: -97
Score: 5.85457
Sequence: ATTCAAACGGCCGTTTGACG
Locus tag: LHK_02892
Name: etfD
Funciton: Electron transfer flavoprotein-ubiquinone oxidoreductase (EC 1.5.5.1)
etfD -97 5.9 ATTCAAACGGCCGTTTGACG LHK_02892