Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing acdH gene

Properties
Regulog: PsrA - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/beta
Built upon 34 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chromobacterium violaceum ATCC 12472
Position: -106
Score: 5.68419
Sequence: ATTTAAACAAACGTTTGAAC
Locus tag: CV1785
Name: acdH
Funciton: Probable acyl-CoA dehydrogenase
acdH -106 5.7 ATTTAAACAAACGTTTGAAC CV1785
Laribacter hongkongensis HLHK9
Position: -54
Score: 5.95297
Sequence: ATCCAAACATTCGTTTGAAA
Position: -21
Score: 5.48601
Sequence: TTTCAAACGGTCGTTTAACC
Locus tag: LHK_02264
Name: acdH
Funciton: Probable acyl-CoA dehydrogenase
acdH -54 6 ATCCAAACATTCGTTTGAAA LHK_02264
-21 5.5 TTTCAAACGGTCGTTTAACC