Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing fadH gene

Properties
Regulog: PsrA - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/beta
Built upon 34 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Laribacter hongkongensis HLHK9
Position: 43
Score: 5.96959
Sequence: AATCAAACGGTCGTTTGACA
Locus tag: LHK_00049
Name: fadH
Funciton: 2,4-dienoyl-CoA reductase [NADPH] (EC 1.3.1.34)
fadH 43 6 AATCAAACGGTCGTTTGACA LHK_00049