Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing fabK gene

Properties
Regulog: PsrA - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/beta
Built upon 34 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chromobacterium violaceum ATCC 12472
Position: -78
Score: 6.03289
Sequence: ATTAAAACATTCGTTTGAAA
Locus tag: CV2194
Name: fabK
Funciton: Enoyl-[acyl-carrier-protein] reductase [FMN] (EC 1.3.1.9)
fabK -78 6 ATTAAAACATTCGTTTGAAA CV2194