Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing acdH2 gene

Regulog: PsrA - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/beta
Built upon 34 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chromobacterium violaceum ATCC 12472
Position: -101
Score: 5.93636
Locus tag: CV3818
Name: etfB
Funciton: Electron transfer flavoprotein, beta subunit
Locus tag: CV3817
Name: etfA
Funciton: Electron transfer flavoprotein, alpha subunit
Locus tag: CV3816
Name: acdH2
Funciton: Acyl-CoA dehydrogenase (EC
etfB-etfA-acdH2 -101 5.9 AACCAAACGCTCGTTTGAAT CV3818
Laribacter hongkongensis HLHK9
Position: -187
Score: 6.13001
Locus tag: LHK_02913
Name: etfB
Funciton: Electron transfer flavoprotein, beta subunit
Locus tag: LHK_02912
Name: etfA
Funciton: Electron transfer flavoprotein, alpha subunit
Locus tag: LHK_02910
Name: acdH2
Funciton: Acyl-CoA dehydrogenase (EC
etfB-etfA-acdH2 -187 6.1 ATTCAAACGACTGTTTGAAG LHK_02913