Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing Daro_1552 gene

Properties
Regulog: PsrA - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/beta
Built upon 34 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Dechloromonas aromatica RCB
Position: -58
Score: 5.98978
Sequence: ATTCAAACGTTCGTTTTATT
Locus tag: Daro_1549
Name: acdB
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) / 3,2-trans-enoyl-CoA isomerase (EC 5.3.3.8) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)
Locus tag: Daro_1550
Name: acdA
Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
Locus tag: Daro_1551
Name: null
Funciton: hypothetical protein
Locus tag: Daro_1552
Name: null
Funciton: FIG026291: Hypothetical periplasmic protein
Locus tag: Daro_1553
Name: fadD
Funciton: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)
Locus tag: Daro_1554
Name: null
Funciton: Dioxygenases related to 2-nitropropane dioxygenase
Locus tag: Daro_1555
Name: acdH
Funciton: Acyl-CoA dehydrogenase (EC 1.3.99.3)
acdB-acdA-Daro_1551-Daro_1552-fadD-Daro_1554-acdH -58 6 ATTCAAACGTTCGTTTTATT Daro_1549