Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing Daro_1546 gene

Properties
Regulog: PsrA - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/beta
Built upon 34 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Dechloromonas aromatica RCB
Position: -34
Score: 5.99814
Sequence: ATTCAAACGAACGTATGAAT
Locus tag: Daro_1543
Name: psrA
Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: Daro_1544
Name: fadE
Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
Locus tag: Daro_1545
Name: fadA
Funciton: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)
Locus tag: Daro_1546
Name: null
Funciton: DegV family protein
Locus tag: Daro_1547
Name: fadB
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
psrA-fadE-fadA-Daro_1546-fadB -34 6 ATTCAAACGAACGTATGAAT Daro_1543