Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing fadL gene

Regulog: PsrA - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/beta
Built upon 34 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Azoarcus sp. EbN1
Position: -28
Score: 6.30502
Locus tag: c1A220
Name: psrA
Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: c1A18
Name: fadE
Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC
Locus tag: c1A212
Name: fadA
Funciton: 3-ketoacyl-CoA thiolase (EC @ Acetyl-CoA acetyltransferase (EC
Locus tag: c1A208
Name: fadB
Funciton: Enoyl-CoA hydratase (EC / 3-hydroxyacyl-CoA dehydrogenase (EC / 3-hydroxybutyryl-CoA epimerase (EC
Locus tag: c1A206
Name: null
Funciton: Acyl-CoA hydrolase (EC
Locus tag: c1A203
Name: fadL
Funciton: Long-chain fatty acid transport protein
Locus tag: ebA2315
Name: acdB
Funciton: Enoyl-CoA hydratase (EC / 3,2-trans-enoyl-CoA isomerase (EC / 3-hydroxyacyl-CoA dehydrogenase (EC
Locus tag: ebA2314
Name: acdA
Funciton: 3-ketoacyl-CoA thiolase (EC @ Acetyl-CoA acetyltransferase (EC
Locus tag: ebA2313
Name: echH
Funciton: Enoyl-CoA hydratase (EC
psrA-fadE-fadA-fadB-c1A206-fadL-acdB-acdA-echH -28 6.3 ATTAAAACGATCGTTTGAAT c1A220
Chromobacterium violaceum ATCC 12472
Position: -136
Score: 4.84986
Position: -84
Score: 5.56132
Position: -71
Score: 5.34233
Locus tag: CV2724
Name: psrA
Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: CV2723
Name: fadE
Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC
Locus tag: CV2722
Name: null
Funciton: Acyl-CoA hydrolase (EC
Locus tag: CV2721
Name: fadL
Funciton: Long-chain fatty acid transport protein
psrA-fadE-CV2722-fadL -136 4.8 CATTAAACGAACGTTTGGAA CV2724
Dechloromonas aromatica RCB
Position: -122
Score: 4.68328
Position: -83
Score: 5.84216
Locus tag: Daro_1548
Name: fadL
Funciton: Long-chain fatty acid transport protein
fadL -122 4.7 TTTCCAACAGTCATTTGAAT Daro_1548
Laribacter hongkongensis HLHK9
Position: -142
Score: 5.59656
Position: -63
Score: 4.91262
Locus tag: LHK_01608
Name: fadL
Funciton: Long-chain fatty acid transport protein
Locus tag: LHK_01609
Name: acdB
Funciton: Enoyl-CoA hydratase (EC / 3,2-trans-enoyl-CoA isomerase (EC / 3-hydroxyacyl-CoA dehydrogenase (EC
Locus tag: LHK_01610
Name: acdA
Funciton: 3-ketoacyl-CoA thiolase (EC @ Acetyl-CoA acetyltransferase (EC
fadL-acdB-acdA -142 5.6 TATAAAACGGCTGTTTGAAA LHK_01608
Thauera sp. MZ1T
Position: -34
Score: 4.65712
Position: -21
Score: 6.20648
Locus tag: Tmz1t_0804
Name: psrA
Funciton: Predicted transcriptional regulator for fatty acid degradation PsrA, TetR family
Locus tag: Tmz1t_0805
Name: fadE
Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC
Locus tag: Tmz1t_0806
Name: fadA
Funciton: 3-ketoacyl-CoA thiolase (EC @ Acetyl-CoA acetyltransferase (EC
Locus tag: Tmz1t_0807
Name: fadB
Funciton: Enoyl-CoA hydratase (EC / 3-hydroxyacyl-CoA dehydrogenase (EC / 3-hydroxybutyryl-CoA epimerase (EC
Locus tag: Tmz1t_0808
Name: fadL
Funciton: Long-chain fatty acid transport protein
Locus tag: Tmz1t_0809
Name: acdB
Funciton: Enoyl-CoA hydratase (EC / 3,2-trans-enoyl-CoA isomerase (EC / 3-hydroxyacyl-CoA dehydrogenase (EC
Locus tag: Tmz1t_0810
Name: acdA
Funciton: 3-ketoacyl-CoA thiolase (EC @ Acetyl-CoA acetyltransferase (EC
psrA-fadE-fadA-fadB-fadL-acdB-acdA -34 4.7 AAGAAAACGTATGATTCAAA Tmz1t_0804