Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing potC gene

Regulog: PuuR - Thermotogales
Regulator type: Transcription factor
Regulator family: XRE
Regulation mode:
Biological process: Spermidine biosynthesis
Effector: Putrescine
Phylum: Thermotogae
Built upon 16 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermosipho africanus TCF52B
Position: -59
Score: 4.49399
Position: -36
Score: 5.6224
Locus tag: THA_1405
Name: puuR
Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
Locus tag: THA_1404
Name: speD
Funciton: S-adenosylmethionine decarboxylase proenzyme (EC, prokaryotic class 1B
Locus tag: THA_1403
Name: speE
Funciton: Spermidine synthase (EC
Locus tag: THA_1402
Name: potF
Funciton: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2)
Locus tag: THA_1401
Name: potA
Funciton: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1)
Locus tag: THA_1400
Name: potB
Funciton: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1)
Locus tag: THA_1399
Name: potC
Funciton: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)
puuR-speD-speE-potF-potA-potB-potC -59 4.5 ATGTTCTGTATCATAGACAT THA_1405
Thermosipho melanesiensis BI429
Position: -32
Score: 5.48714
Locus tag: Tmel_0572
Name: puuR
Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
Locus tag: Tmel_0571
Name: speD
Funciton: S-adenosylmethionine decarboxylase proenzyme (EC, prokaryotic class 1B
Locus tag: Tmel_0570
Name: speE
Funciton: Spermidine synthase (EC
Locus tag: Tmel_0569
Name: potF
Funciton: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2)
Locus tag: Tmel_0568
Name: potA
Funciton: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1)
Locus tag: Tmel_0567
Name: potB
Funciton: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1)
Locus tag: Tmel_0566
Name: potC
Funciton: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)
puuR-speD-speE-potF-potA-potB-potC -32 5.5 TTGTTTAGTATTATAGACAT Tmel_0572