Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing puuR gene

Regulog: PuuR - Thermotogales
Regulator type: Transcription factor
Regulator family: XRE
Regulation mode:
Biological process: Spermidine biosynthesis
Effector: Putrescine
Phylum: Thermotogae
Built upon 16 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Fervidobacterium nodosum Rt17-B1
Position: -134
Score: 4.90103
Locus tag: Fnod_1327
Name: speD
Funciton: S-adenosylmethionine decarboxylase proenzyme (EC, prokaryotic class 1B
Locus tag: Fnod_1326
Name: speE
Funciton: Spermidine synthase (EC
Locus tag: Fnod_1325
Name: puuR
Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
speD-speE-puuR -134 4.9 TTGTTCACTTAAGTAAACAT Fnod_1327
Thermosipho africanus TCF52B
Position: -59
Score: 4.49399
Position: -36
Score: 5.6224
Locus tag: THA_1405
Name: puuR
Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
Locus tag: THA_1404
Name: speD
Funciton: S-adenosylmethionine decarboxylase proenzyme (EC, prokaryotic class 1B
Locus tag: THA_1403
Name: speE
Funciton: Spermidine synthase (EC
Locus tag: THA_1402
Name: potF
Funciton: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2)
Locus tag: THA_1401
Name: potA
Funciton: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1)
Locus tag: THA_1400
Name: potB
Funciton: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1)
Locus tag: THA_1399
Name: potC
Funciton: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)
puuR-speD-speE-potF-potA-potB-potC -59 4.5 ATGTTCTGTATCATAGACAT THA_1405
Thermosipho melanesiensis BI429
Position: -32
Score: 5.48714
Locus tag: Tmel_0572
Name: puuR
Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
Locus tag: Tmel_0571
Name: speD
Funciton: S-adenosylmethionine decarboxylase proenzyme (EC, prokaryotic class 1B
Locus tag: Tmel_0570
Name: speE
Funciton: Spermidine synthase (EC
Locus tag: Tmel_0569
Name: potF
Funciton: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2)
Locus tag: Tmel_0568
Name: potA
Funciton: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1)
Locus tag: Tmel_0567
Name: potB
Funciton: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1)
Locus tag: Tmel_0566
Name: potC
Funciton: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)
puuR-speD-speE-potF-potA-potB-potC -32 5.5 TTGTTTAGTATTATAGACAT Tmel_0572
Thermotoga lettingae TMO
Position: -220
Score: 5.1977
Position: -62
Score: 5.47712
Locus tag: Tlet_0752
Name: puuR
Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
Locus tag: Tlet_0753
Name: speD
Funciton: S-adenosylmethionine decarboxylase proenzyme (EC, prokaryotic class 1B
Locus tag: Tlet_0754
Name: speE
Funciton: Spermidine synthase (EC
puuR-speD-speE -220 5.2 TTGTTGAGGATAATTGACAA Tlet_0752
Thermotoga maritima MSB8
Position: -58
Score: 4.76475
Position: -36
Score: 6.8092
Locus tag: TM0656
Name: puuR
Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
Locus tag: TM0655
Name: speD
Funciton: S-adenosylmethionine decarboxylase proenzyme (EC, prokaryotic class 1B
Locus tag: TM0654
Name: speE
Funciton: Spermidine synthase (EC
puuR-speD-speE -58 4.8 ATGTCTGTGATACTGAACAA TM0656
Thermotoga naphthophila RKU-10
Position: -58
Score: 4.76475
Position: -36
Score: 6.8092
Locus tag: Tnap_0452
Name: puuR
Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
Locus tag: Tnap_0451
Name: speD
Funciton: S-adenosylmethionine decarboxylase proenzyme (EC, prokaryotic class 1B
Locus tag: Tnap_0450
Name: speE
Funciton: Spermidine synthase (EC
puuR-speD-speE -58 4.8 ATGTCTGTGATACTGAACAA Tnap_0452
Thermotoga neapolitana DSM 4359
Position: -22
Score: 4.76475
Position: 0
Score: 6.42085
Locus tag: CTN_0001
Name: puuR
Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
Locus tag: CTN_0002
Name: speD
Funciton: S-adenosylmethionine decarboxylase proenzyme (EC, prokaryotic class 1B
Locus tag: CTN_0003
Name: speE
Funciton: Spermidine synthase (EC
puuR-speD-speE -22 4.8 ATGTCTGTGATACTGAACAA CTN_0001
Thermotoga petrophila RKU-1
Position: -22
Score: 4.76475
Position: 0
Score: 6.8092
Locus tag: Tpet_0275
Name: puuR
Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
Locus tag: Tpet_0276
Name: speD
Funciton: S-adenosylmethionine decarboxylase proenzyme (EC, prokaryotic class 1B
Locus tag: Tpet_0277
Name: speE
Funciton: Spermidine synthase (EC
puuR-speD-speE -22 4.8 ATGTCTGTGATACTGAACAA Tpet_0275
Thermotoga sp. RQ2
Position: -58
Score: 4.76475
Position: -36
Score: 6.8092
Locus tag: TRQ2_0273
Name: puuR
Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family
Locus tag: TRQ2_0274
Name: speD
Funciton: S-adenosylmethionine decarboxylase proenzyme (EC, prokaryotic class 1B
Locus tag: TRQ2_0275
Name: speE
Funciton: Spermidine synthase (EC
puuR-speD-speE -58 4.8 ATGTCTGTGATACTGAACAA TRQ2_0273