Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing fdnG-2 gene

Properties
Regulog: ModE2 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Phylum: Proteobacteria/delta
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio vulgaris str. Miyazaki F
Position: -179
Score: 4.7232
Sequence: ATTCTGTCAGGATAGGCATATA
Locus tag: DvMF_2533
Name: null
Funciton: formate dehydrogenase alpha subunit
Locus tag: DvMF_2534
Name: null
Funciton: formate dehydrogenase, beta subunit
DvMF_2533-DvMF_2534 -179 4.7 ATTCTGTCAGGATAGGCATATA DvMF_2533