Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing DVU2405 gene

Properties
Regulog: ModE2 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Phylum: Proteobacteria/delta
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio vulgaris Hildenborough
Position: -332
Score: 4.80559
Sequence: TCTATGTTTTTTCTGGCATATG
Locus tag: DVU2405
Name: null
Funciton: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
DVU2405 -332 4.8 TCTATGTTTTTTCTGGCATATG DVU2405
Desulfovibrio vulgaris str. Miyazaki F
Position: -331
Score: 5.22062
Sequence: ATTATGCTTTTTCAGACATATG
Locus tag: DvMF_0321
Name: null
Funciton: Alcohol dehydrogenase (EC 1.1.1.1); Acetaldehyde dehydrogenase (EC 1.2.1.10)
DvMF_0321 -331 5.2 ATTATGCTTTTTCAGACATATG DvMF_0321