Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.3 --

Orthologous regulated operons containing mop gene

Regulog: ModE2 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Phylum: Proteobacteria/delta
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfohalobium retbaense DSM 5692
Position: -166
Score: 4.59487
Locus tag: Dret_1807
Name: null
Funciton: molybdopterin binding domain protein
Locus tag: Dret_1808
Name: null
Funciton: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
Dret_1807-Dret_1808 -166 4.6 GCTATGCAAAAAATCACATAAG Dret_1807
Desulfomicrobium baculatum DSM 4028
Position: -192
Score: 4.98562
Position: -63
Score: 5.37612
Locus tag: Dbac_1563
Name: null
Funciton: molybdopterin binding domain protein
Locus tag: Dbac_1562
Name: null
Funciton: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
Dbac_1563-Dbac_1562 -192 5 GTTATGCCTTTCCGGGCATATT Dbac_1563
Desulfovibrio desulfuricans G20
Position: -66
Score: 4.69966
Locus tag: Dde_3538
Name: null
Funciton: molybdopterin binding domain protein
Locus tag: Dde_3539
Name: null
Funciton: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
Dde_3538-Dde_3539 -66 4.7 AATATGCCTGCACAGGCATATG Dde_3538
Desulfovibrio salexigens DSM 2638
Position: -336
Score: 5.18044
Position: -114
Score: 5.24142
Locus tag: Desal_0300
Name: null
Funciton: molybdopterin binding domain protein
Locus tag: Desal_0299
Name: null
Funciton: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding
Desal_0300-Desal_0299 -336 5.2 ATTATGTCATTTTGGACCTAAT Desal_0300
Desulfovibrio vulgaris Hildenborough
Position: -111
Score: 4.30809
Locus tag: DVU1560
Name: null
Funciton: molybdopterin binding domain protein
Locus tag: DVU1559
Name: mop
Funciton: aldehyde oxidase and xanthine dehydrogenase molybdopterin binding