Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing DMR_02370 gene

Properties
Regulog: ModE2 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Phylum: Proteobacteria/delta
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio magneticus RS-1
Position: -327
Score: 4.20288
Sequence: ATAATATTTAAAATAACATAGT
Locus tag: DMR_02370
Name: null
Funciton: putative tungsten-containing aldehyde ferredoxin oxidoreductase
DMR_02370 -327 4.2 ATAATATTTAAAATAACATAGT DMR_02370
Desulfovibrio vulgaris str. Miyazaki F
Position: -310
Score: 4.65426
Sequence: AATGTGTCACCATTGACATAGT
Position: -258
Score: 4.62984
Sequence: CCTATGTCATGCAAGGCATAAA
Locus tag: DvMF_1956
Name: null
Funciton: putative tungsten-containing aldehyde ferredoxin oxidoreductase
DvMF_1956 -310 4.7 AATGTGTCACCATTGACATAGT DvMF_1956
-258 4.6 CCTATGTCATGCAAGGCATAAA