Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.3 --

Orthologous regulated operons containing nifN gene

Regulog: ModE2 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Phylum: Proteobacteria/delta
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio magneticus RS-1
Position: -312
Score: 4.75058
Locus tag: DMR_17520
Name: nifE
Funciton: Nitrogenase FeMo-cofactor scaffold and assembly protein NifE
Locus tag: DMR_17510
Name: nifN
Funciton: Nitrogenase FeMo-cofactor scaffold and assembly protein NifN
Locus tag: DMR_17500
Name: nifB
Funciton: Nitrogenase FeMo-cofactor synthesis FeS core scaffold and assembly protein NifB
nifE-nifN-nifB -312 4.8 GTTGTGTCAAAACAGACAGAAG DMR_17520