Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing fdhD gene

Properties
Regulog: ModE2 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Phylum: Proteobacteria/delta
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio salexigens DSM 2638
Position: -143
Score: 4.80797
Sequence: TCTATGTCAATATGAGCACAAT
Locus tag: Desal_2877
Name: null
Funciton: formate dehydrogenase family accessory protein FdhD
Desal_2877 -143 4.8 TCTATGTCAATATGAGCACAAT Desal_2877