Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing phsB gene

Properties
Regulog: ModE2 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Phylum: Proteobacteria/delta
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio vulgaris str. Miyazaki F
Position: -216
Score: 5.08254
Sequence: CATATGTCTGAAAAAGCATAAT
Locus tag: DvMF_0320
Name: phsA
Funciton: molybdopterin oxidoreductase
Locus tag: DvMF_0319
Name: null
Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein
phsA-DvMF_0319 -216 5.1 CATATGTCTGAAAAAGCATAAT DvMF_0320