Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing mop gene

Properties
Regulog: ModE2 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Phylum: Proteobacteria/delta
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio magneticus RS-1
Position: -142
Score: 5.35298
Sequence: AATGTGTTAATAATAACATAAC
Locus tag: DMR_17150
Name: mop
Funciton: molybdenum-pterin binding protein
mop -142 5.4 AATGTGTTAATAATAACATAAC DMR_17150