Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing moaA gene

Regulog: ModE2 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Phylum: Proteobacteria/delta
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio salexigens DSM 2638
Position: -178
Score: 4.93638
Position: -78
Score: 4.13426
Locus tag: Desal_2878
Name: null
Funciton: formate dehydrogenase formation protein FdhE
Locus tag: Desal_2879
Name: null
Funciton: Molybdenum cofactor biosynthesis protein MoaA
Desal_2878-Desal_2879 -178 4.9 ATTATACCATTTTAGCCATAAT Desal_2878