Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing modE gene

Properties
Regulog: ModE2 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Phylum: Proteobacteria/delta
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfomicrobium baculatum DSM 4028
Position: -227
Score: 5.03375
Sequence: ATGATGCCAAACAAGGCATAAT
Locus tag: Dbac_1566
Name: null
Funciton: Formylmethanofuran dehydrogenase subunit E
Locus tag: Dbac_1565
Name: null
Funciton: Transcriptional regulator, ModE family
Dbac_1566-Dbac_1565 -227 5 ATGATGCCAAACAAGGCATAAT Dbac_1566
Desulfovibrio salexigens DSM 2638
Position: -48
Score: 5.06694
Sequence: ATTGTGCCCTATACGGCATAAT
Locus tag: Desal_2666
Name: null
Funciton: Formylmethanofuran dehydrogenase subunit E
Locus tag: Desal_2665
Name: null
Funciton: Transcriptional regulator, ModE family
Desal_2666-Desal_2665 -48 5.1 ATTGTGCCCTATACGGCATAAT Desal_2666
Desulfovibrio vulgaris str. Miyazaki F
Position: -143
Score: 4.3038
Sequence: ATTATGTCATTATGAGCAGGTA
Locus tag: DvMF_0650
Name: null
Funciton: Transcriptional regulator, ModE family
DvMF_0650 -143 4.3 ATTATGTCATTATGAGCAGGTA DvMF_0650