Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing tupC gene

Regulog: ModE2 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Phylum: Proteobacteria/delta
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfomicrobium baculatum DSM 4028
Position: -62
Score: 5.04009
Position: -32
Score: 4.36282
Locus tag: Dbac_3402
Name: null
Funciton: ABC-type tungstate transport system, periplasmic binding protein
Locus tag: Dbac_3403
Name: null
Funciton: ABC-type tungstate transport system, permease protein
Locus tag: Dbac_3404
Name: null
Funciton: ABC-type tungstate transport system, ATP-binding protein
Dbac_3402-Dbac_3403-Dbac_3404 -62 5 CTTGTGTCTGATTTGGCATATG Dbac_3402
Desulfovibrio desulfuricans G20
Position: -65
Score: 4.35244
Locus tag: Dde_0234
Name: null
Funciton: ABC-type tungstate transport system, periplasmic binding protein
Locus tag: Dde_0233
Name: cysW
Funciton: ABC-type tungstate transport system, permease protein
Locus tag: Dde_0232
Name: cysA
Funciton: ABC-type tungstate transport system, ATP-binding protein
Dde_0234-cysW-cysA -65 4.4 ATTGTGTTTTATTTAGCTGATT Dde_0234
Desulfovibrio magneticus RS-1
Position: -30
Score: 4.0888
Locus tag: DMR_12510
Name: null
Funciton: ABC-type tungstate transport system, periplasmic binding protein
Locus tag: DMR_12520
Name: null
Funciton: ABC-type tungstate transport system, permease protein
Locus tag: DMR_12530
Name: null
Funciton: ABC-type tungstate transport system, ATP-binding protein
DMR_12510-DMR_12520-DMR_12530 -30 4.1 GTTAAGTTAAATTTGACAGAGG DMR_12510
Desulfovibrio salexigens DSM 2638
Position: -245
Score: 4.08608
Position: -136
Score: 4.80501
Locus tag: Desal_2876
Name: null
Funciton: ABC-type tungstate transport system, periplasmic binding protein
Locus tag: Desal_2875
Name: null
Funciton: ABC-type tungstate transport system, permease protein
Locus tag: Desal_2874
Name: null
Funciton: ABC-type tungstate transport system, ATP-binding protein
Desal_2876-Desal_2875-Desal_2874 -245 4.1 GATATATTTTAAACAGCATAGG Desal_2876
Desulfovibrio vulgaris str. Miyazaki F
Position: -227
Score: 4.50698
Locus tag: DvMF_2780
Name: null
Funciton: ABC-type tungstate transport system, periplasmic binding protein
Locus tag: DvMF_2781
Name: null
Funciton: ABC-type tungstate transport system, permease protein
Locus tag: DvMF_2782
Name: null
Funciton: ABC-type tungstate transport system, ATP-binding protein
DvMF_2780-DvMF_2781-DvMF_2782 -227 4.5 GTTCTGTTTTTTTCAACATGTT DvMF_2780