Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing aor-4 gene

Properties
Regulog: ModE2 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Phylum: Proteobacteria/delta
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfomicrobium baculatum DSM 4028
Position: -120
Score: 4.92698
Sequence: GTTATGTCACCCATGACATATG
Locus tag: Dbac_2970
Name: null
Funciton: Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)
Dbac_2970 -120 4.9 GTTATGTCACCCATGACATATG Dbac_2970
Desulfovibrio desulfuricans G20
Position: -196
Score: 4.60893
Sequence: TTTAGGTTAAAAATAACTTAAT
Locus tag: Dde_2460
Name: aor-4
Funciton: Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)
aor-4 -196 4.6 TTTAGGTTAAAAATAACTTAAT Dde_2460
Desulfovibrio salexigens DSM 2638
Position: -169
Score: 5.28822
Sequence: AATATGCCAAAAAAGATATAAT
Locus tag: Desal_1641
Name: null
Funciton: Tungsten-containing aldehyde ferredoxin oxidoreductase (EC 1.2.7.-)
Desal_1641 -169 5.3 AATATGCCAAAAAAGATATAAT Desal_1641