Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing Dde_0715 gene

Properties
Regulog: ModE2 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Phylum: Proteobacteria/delta
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfohalobium retbaense DSM 5692
Position: -10
Score: 4.96014
Sequence: GTTATGTTTTATGAGGCATAAC
Locus tag: Dret_0225
Name: null
Funciton: hypothetical protein
Locus tag: Dret_0226
Name: null
Funciton: formate dehydrogenase, alpha subunit
Locus tag: Dret_0227
Name: null
Funciton: formate dehydrogenase, beta subunit
Dret_0225-Dret_0226-Dret_0227 -10 5 GTTATGTTTTATGAGGCATAAC Dret_0225
Desulfovibrio desulfuricans G20
Position: -177
Score: 5.36046
Sequence: GTTCTGCTATTATTAACATATT
Locus tag: Dde_0715
Name: null
Funciton: hypothetical protein
Locus tag: Dde_0716
Name: null
Funciton: formate dehydrogenase, alpha subunit
Locus tag: Dde_0717
Name: null
Funciton: formate dehydrogenase, alpha subunit
Locus tag: Dde_0718
Name: ,
Funciton: formate dehydrogenase, beta subunit
Dde_0715-Dde_0716-Dde_0717-, -177 5.4 GTTCTGCTATTATTAACATATT Dde_0715
Desulfovibrio vulgaris Hildenborough
Position: -170
Score: 4.60097
Sequence: TGTGTGTTAATTGTAACATATT
Locus tag: DVU0586
Name: null
Funciton: hypothetical protein
Locus tag: DVU0587
Name: fdnG-1
Funciton: formate dehydrogenase, alpha subunit
Locus tag: DVU0588
Name: hybA
Funciton: formate dehydrogenase, beta subunit
DVU0586-fdnG-1-hybA -170 4.6 TGTGTGTTAATTGTAACATATT DVU0586