Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing fdhD gene

Properties
Regulog: ModE2 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Phylum: Proteobacteria/delta
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio desulfuricans G20
Position: -133
Score: 5.20211
Sequence: GTTGTGTTAATATTAACACATT
Locus tag: Dde_3512
Name: fdnG
Funciton: formate dehydrogenase alpha subunit
Locus tag: Dde_3513
Name: null
Funciton: formate dehydrogenase, alpha subunit
Locus tag: Dde_3514
Name: null
Funciton: Formate dehydrogenase O beta subunit (EC 1.2.1.2)
Locus tag: Dde_3515
Name: null
Funciton: formate dehydrogenase formation protein FdhE, putative
Locus tag: Dde_3516
Name: fdhD
Funciton: Formate dehydrogenase chain D (EC 1.2.1.2)
fdnG-Dde_3513-Dde_3514-Dde_3515-fdhD -133 5.2 GTTGTGTTAATATTAACACATT Dde_3512