Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing DVU2809 gene

Properties
Regulog: ModE2 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Phylum: Proteobacteria/delta
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfovibrio vulgaris Hildenborough
Position: -333
Score: 4.21231
Sequence: TATATGTTTTATTTAACCTACT
Locus tag: DVU2812
Name: fdnG-3
Funciton: formate dehydrogenase, alpha subunit
Locus tag: DVU2811
Name: null
Funciton: Formate dehydrogenase O beta subunit (EC 1.2.1.2)
Locus tag: DVU2810
Name: null
Funciton: formate dehydrogenase formation protein FdhE, putative
Locus tag: DVU2809
Name: null
Funciton: cytochrome c3
fdnG-3-DVU2811-DVU2810-DVU2809 -333 4.2 TATATGTTTTATTTAACCTACT DVU2812