Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing fdhB gene

Regulog: ModE2 - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdenum
Phylum: Proteobacteria/delta
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfomicrobium baculatum DSM 4028
Position: -125
Score: 4.78946
Locus tag: Dbac_1570
Name: null
Funciton: formate dehydrogenase, alpha subunit
Locus tag: Dbac_1569
Name: null
Funciton: Formate dehydrogenase O beta subunit (EC
Locus tag: Dbac_1568
Name: null
Funciton: formate dehydrogenase formation protein FdhE, putative
Dbac_1570-Dbac_1569-Dbac_1568 -125 4.8 TATGTATTATTTATAACATATT Dbac_1570
Desulfovibrio desulfuricans G20
Position: -133
Score: 5.20211
Locus tag: Dde_3512
Name: fdnG
Funciton: formate dehydrogenase alpha subunit
Locus tag: Dde_3513
Name: null
Funciton: formate dehydrogenase, alpha subunit
Locus tag: Dde_3514
Name: null
Funciton: Formate dehydrogenase O beta subunit (EC
Locus tag: Dde_3515
Name: null
Funciton: formate dehydrogenase formation protein FdhE, putative
Locus tag: Dde_3516
Name: fdhD
Funciton: Formate dehydrogenase chain D (EC
fdnG-Dde_3513-Dde_3514-Dde_3515-fdhD -133 5.2 GTTGTGTTAATATTAACACATT Dde_3512
Desulfovibrio magneticus RS-1
Position: -226
Score: 4.36446
Position: -81
Score: 4.57024
Locus tag: DMR_15760
Name: null
Funciton: formate dehydrogenase alpha subunit
Locus tag: DMR_15750
Name: null
Funciton: formate dehydrogenase, alpha subunit
Locus tag: DMR_15740
Name: null
Funciton: Formate dehydrogenase O beta subunit (EC
Locus tag: DMR_15730
Name: null
Funciton: formate dehydrogenase formation protein FdhE, putative
DMR_15760-DMR_15750-DMR_15740-DMR_15730 -226 4.4 TTTGTATTTAAAATAACTTAAT DMR_15760
Desulfovibrio salexigens DSM 2638
Position: -127
Score: 4.96317
Locus tag: Desal_2659
Name: null
Funciton: formate dehydrogenase, alpha subunit
Locus tag: Desal_2658
Name: null
Funciton: Formate dehydrogenase O beta subunit (EC
Locus tag: Desal_2657
Name: null
Funciton: formate dehydrogenase formation protein FdhE, putative
Desal_2659-Desal_2658-Desal_2657 -127 5 TATGTGCTAAATCTAACATATT Desal_2659
Desulfovibrio vulgaris Hildenborough
Position: -333
Score: 4.21231
Locus tag: DVU2812
Name: fdnG-3
Funciton: formate dehydrogenase, alpha subunit
Locus tag: DVU2811
Name: null
Funciton: Formate dehydrogenase O beta subunit (EC
Locus tag: DVU2810
Name: null
Funciton: formate dehydrogenase formation protein FdhE, putative
Locus tag: DVU2809
Name: null
Funciton: cytochrome c3
fdnG-3-DVU2811-DVU2810-DVU2809 -333 4.2 TATATGTTTTATTTAACCTACT DVU2812