Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing modB gene

Properties
Regulog: ModE - Vibrionales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/gamma
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -50
Score: 7.32705
Sequence: CGATATGTAGTAAGGTATATATCG
Locus tag: PBPRB1349
Name: modA
Funciton: Molybdate ABC transporter, substrate-binding protein
Locus tag: PBPRB1348
Name: modB
Funciton: Molybdate ABC transporter, permease protein
Locus tag: PBPRB1347
Name: modC
Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC -50 7.3 CGATATGTAGTAAGGTATATATCG PBPRB1349
Vibrio angustum S14
Position: -43
Score: 7.64432
Sequence: CGATATGTAGTTTACTATATATCG
Locus tag: VAS14_11339
Name: modA
Funciton: Molybdate ABC transporter, substrate-binding protein
Locus tag: VAS14_11344
Name: modB
Funciton: Molybdate ABC transporter, permease protein
Locus tag: VAS14_11349
Name: modC
Funciton: Molybdate ABC transporter, ATP-binding protein
modA-modB-modC -43 7.6 CGATATGTAGTTTACTATATATCG VAS14_11339