Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing rbsB gene

Properties
Regulog: RbsR - Vibrionales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Proteobacteria/gamma
Built upon 15 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -118
Score: 5.73617
Sequence: CCATCGAAACGTTTGCGTAA
Locus tag: PBPRB1556
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: PBPRB1557
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: PBPRB1558
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: PBPRB1559
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: PBPRB1560
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: PBPRB1561
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
rbsD-rbsA-rbsC-rbsB-rbsK-rbsR -118 5.7 CCATCGAAACGTTTGCGTAA PBPRB1556
Vibrio angustum S14
Position: -226
Score: 6.75955
Sequence: TTATCGAAACGTTTCGATGG
Position: -96
Score: 6.62481
Sequence: CTATCGAAACGTTTCGATGG
Locus tag: VAS14_09005
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: VAS14_09010
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: VAS14_09015
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: VAS14_09020
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: VAS14_09025
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: VAS14_09030
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
rbsD-rbsA-rbsC-rbsB-rbsK-rbsR -226 6.8 TTATCGAAACGTTTCGATGG VAS14_09005
-96 6.6 CTATCGAAACGTTTCGATGG
Vibrio cholerae O1 biovar eltor str. N16961
Position: -86
Score: 6.98537
Sequence: TCATCGAAACGTTTCGATGT
Locus tag: VCA0127
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: VCA0128
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: VCA0129
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: VCA0130
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: VCA0131
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: VCA0132
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
rbsD-rbsA-rbsC-rbsB-rbsK-rbsR -86 7 TCATCGAAACGTTTCGATGT VCA0127
Vibrio fischeri ES114
Position: -71
Score: 6.39547
Sequence: TTACGCAAACGTTTCGATGA
Locus tag: VF_1444
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: VF_1445
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: VF_1446
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: VF_1447
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: VF_1448
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: VF_1449
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
rbsD-rbsA-rbsC-rbsB-rbsK-rbsR -71 6.4 TTACGCAAACGTTTCGATGA VF_1444
Vibrio harveyi ATCC BAA-1116
Position: -222
Score: 6.18918
Sequence: CTATCGAAACGTTTCGATTT
Position: -95
Score: 6.98537
Sequence: TCATCGAAACGTTTCGATGT
Locus tag: VIBHAR_06146
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: VIBHAR_06145
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: VIBHAR_06144
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: VIBHAR_06143
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: VIBHAR_06142
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: VIBHAR_06141
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
rbsD-rbsA-rbsC-rbsB-rbsK-rbsR -222 6.2 CTATCGAAACGTTTCGATTT VIBHAR_06146
-95 7 TCATCGAAACGTTTCGATGT
Vibrio parahaemolyticus RIMD 2210633
Position: -226
Score: 7.04507
Sequence: CCATCGAAACGTTTCGATGA
Position: -96
Score: 6.69483
Sequence: GCATCGAAACGTTTCGATGA
Locus tag: VPA1087
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: VPA1086
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: VPA1085
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: VPA1084
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: VPA1083
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: VPA1082
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
rbsD-rbsA-rbsC-rbsB-rbsK-rbsR -226 7 CCATCGAAACGTTTCGATGA VPA1087
-96 6.7 GCATCGAAACGTTTCGATGA
Vibrio salmonicida LFI1238
Position: -70
Score: 6.39547
Sequence: TTACGCAAACGTTTCGATGA
Locus tag: VSAL_I1372
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: VSAL_I1371
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: VSAL_I1370
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: VSAL_I1369
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: VSAL_I1368
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: VSAL_I1367
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
rbsD-rbsA-rbsC-rbsB-rbsK-rbsR -70 6.4 TTACGCAAACGTTTCGATGA VSAL_I1372
Vibrio shilonii AK1
Position: -170
Score: 6.56707
Sequence: TCATCGAAACGTTTCGATAG
Position: -87
Score: 7.17982
Sequence: TCATCGAAACGTTTCGATGA
Locus tag: VSAK1_16182
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: VSAK1_16177
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: VSAK1_16172
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: VSAK1_16167
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: VSAK1_16162
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: VSAK1_16157
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
rbsD-rbsA-rbsC-rbsB-rbsK-rbsR -170 6.6 TCATCGAAACGTTTCGATAG VSAK1_16182
-87 7.2 TCATCGAAACGTTTCGATGA
Vibrio splendidus LGP32
Position: -104
Score: 7.04507
Sequence: CCATCGAAACGTTTCGATGA
Position: -26
Score: 6.62481
Sequence: CTATCGAAACGTTTCGATGG
Locus tag: VS_II0940
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: VS_II0941
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: VS_II0942
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: VS_II0943
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: VS_II0944
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: VS_II0945
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
rbsD-rbsA-rbsC-rbsB-rbsK-rbsR -104 7 CCATCGAAACGTTTCGATGA VS_II0940
-26 6.6 CTATCGAAACGTTTCGATGG
Vibrio vulnificus CMCP6
Position: -72
Score: 7.17982
Sequence: TCATCGAAACGTTTCGATGA
Locus tag: VV20061
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: VV20062
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: VV20063
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: VV20064
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: VV20065
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: VV20066
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI family
rbsD-rbsA-rbsC-rbsB-rbsK-rbsR -72 7.2 TCATCGAAACGTTTCGATGA VV20061