Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing kdgF gene

Regulog: KdgR - Pasteurellales
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor
Biological process: Pectin and polygalacturonate utlization
Effector: 2-keto-3-deoxygluconate
Phylum: Proteobacteria/gamma
Built upon 17 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Actinobacillus succinogenes 130Z
Position: -122
Score: 5.44366
Locus tag: Asuc_1474
Name: kduD
Funciton: 2-deoxy-D-gluconate 3-dehydrogenase (EC
Locus tag: Asuc_1473
Name: spiX
Funciton: predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC
Locus tag: Asuc_1472
Name: kdgK
Funciton: 2-dehydro-3-deoxygluconate kinase (EC
Locus tag: Asuc_1471
Name: eda
Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC
Locus tag: Asuc_1470
Name: kdgF
Funciton: Pectin degradation protein
kduD-spiX-kdgK-eda-kdgF -122 5.4 AATTGAAATTGTATTTCAGAA Asuc_1474
Mannheimia succiniciproducens MBEL55E
Position: -88
Score: 5.94981
Locus tag: MS0563
Name: kduD
Funciton: 2-deoxy-D-gluconate 3-dehydrogenase (EC
Locus tag: MS0564
Name: spiX
Funciton: predicted 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase (EC
Locus tag: MS0565
Name: kdgK
Funciton: 2-dehydro-3-deoxygluconate kinase (EC
Locus tag: MS0566
Name: eda
Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC
Locus tag: MS0567
Name: kdgF
Funciton: Pectin degradation protein
kduD-spiX-kdgK-eda-kdgF -88 5.9 AAATGAAATTATGTTTTATAT MS0563