Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing kdgR gene

Properties
Regulog: KdgR - Pasteurellales
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor
Biological process: Pectin and polygalacturonate utlization
Effector: 2-keto-3-deoxygluconate
Phylum: Proteobacteria/gamma
Built upon 17 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Actinobacillus succinogenes 130Z
Position: -126
Score: 5.44366
Sequence: TTCTGAAATACAATTTCAATT
Locus tag: Asuc_1475
Name: kdgR
Funciton: 2-keto-3-deoxygluconate regulator, IclR family
kdgR -126 5.4 TTCTGAAATACAATTTCAATT Asuc_1475
Mannheimia succiniciproducens MBEL55E
Position: -126
Score: 5.94981
Sequence: ATATAAAACATAATTTCATTT
Locus tag: MS0562
Name: kdgR
Funciton: 2-keto-3-deoxygluconate regulator, IclR family
kdgR -126 5.9 ATATAAAACATAATTTCATTT MS0562