Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing oglO gene

Properties
Regulog: KdgR - Pasteurellales
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor
Biological process: Pectin and polygalacturonate utlization
Effector: 2-keto-3-deoxygluconate
Phylum: Proteobacteria/gamma
Built upon 17 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Actinobacillus succinogenes 130Z
Position: -148
Score: 5.43415
Sequence: TTTTAAAACCATATTTCAATT
Locus tag: Asuc_1477
Name: oglO
Funciton: predicted oligogalacturonate-specific outer membrane porin
oglO -148 5.4 TTTTAAAACCATATTTCAATT Asuc_1477
Mannheimia succiniciproducens MBEL55E
Position: -208
Score: 5.05066
Sequence: ATTAAAAATAAAATTTTAGAA
Position: -170
Score: 5.94633
Sequence: TTTTAAAATATTGTTTTATTT
Position: -107
Score: 5.32864
Sequence: ATTTGACATAGTGTTTCAATT
Locus tag: MS0561
Name: oglO
Funciton: predicted oligogalacturonate-specific outer membrane porin
oglO -208 5.1 ATTAAAAATAAAATTTTAGAA MS0561
-170 5.9 TTTTAAAATATTGTTTTATTT
-107 5.3 ATTTGACATAGTGTTTCAATT