Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing pelX gene

Properties
Regulog: KdgR - Pasteurellales
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor
Biological process: Pectin and polygalacturonate utlization
Effector: 2-keto-3-deoxygluconate
Phylum: Proteobacteria/gamma
Built upon 17 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Actinobacillus succinogenes 130Z
Position: -117
Score: 5.79232
Sequence: TATTAAAATAATGTTTCAAAA
Position: -73
Score: 5.19626
Sequence: AAATAAAATTGTGTTATATTA
Locus tag: Asuc_1469
Name: pelX
Funciton: Exopolygalacturonate lyase (EC 4.2.2.9)
pelX -117 5.8 TATTAAAATAATGTTTCAAAA Asuc_1469
-73 5.2 AAATAAAATTGTGTTATATTA
Mannheimia succiniciproducens MBEL55E
Position: -124
Score: 4.82169
Sequence: TAATAAAATAAAACATTATTT
Position: -119
Score: 6.05124
Sequence: AAATAAAACATTATTTCAAAT
Locus tag: MS1742
Name: pelX
Funciton: Exopolygalacturonate lyase (EC 4.2.2.9)
pelX -124 4.8 TAATAAAATAAAACATTATTT MS1742
-119 6.1 AAATAAAACATTATTTCAAAT