Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing togX gene

Properties
Regulog: KdgR - Pasteurellales
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor
Biological process: Pectin and polygalacturonate utlization
Effector: 2-keto-3-deoxygluconate
Phylum: Proteobacteria/gamma
Built upon 17 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Actinobacillus succinogenes 130Z
Position: -102
Score: 5.04863
Sequence: ATTAAAAATAAAATTTTGTTT
Position: -97
Score: 5.82035
Sequence: AAATAAAATTTTGTTTCAAAA
Locus tag: Asuc_1468
Name: togX
Funciton: predicted oligogalacturonate transporter
Locus tag: Asuc_1467
Name: ogl
Funciton: Oligogalacturonate lyase (EC 4.2.2.6)
togX-ogl -102 5 ATTAAAAATAAAATTTTGTTT Asuc_1468
-97 5.8 AAATAAAATTTTGTTTCAAAA
Mannheimia succiniciproducens MBEL55E
Position: -99
Score: 6.05124
Sequence: AAATAAAACAATGTTTTAAAT
Locus tag: MS1741
Name: togX
Funciton: predicted oligogalacturonate transporter
Locus tag: MS1740
Name: ogl
Funciton: Oligogalacturonate lyase (EC 4.2.2.6)
togX-ogl -99 6.1 AAATAAAACAATGTTTTAAAT MS1741