Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing oglP gene

Regulog: KdgR - Pasteurellales
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor
Biological process: Pectin and polygalacturonate utlization
Effector: 2-keto-3-deoxygluconate
Phylum: Proteobacteria/gamma
Built upon 17 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Actinobacillus succinogenes 130Z
Position: -153
Score: 5.54167
Locus tag: Asuc_1923
Name: oglP
Funciton: predicted oligogalacturonate TRAP transporter, substrate-binding subunit
Locus tag: Asuc_1922
Name: oglQ
Funciton: predicted oligogalacturonate TRAP transporter, small transmembrane subunit
Locus tag: Asuc_1921
Name: oglM
Funciton: predicted oligogalacturonate TRAP transporter, large transmembrane subunit
oglP-oglQ-oglM -153 5.5 ATTCAAAACATAATTTCATTT Asuc_1923
Mannheimia succiniciproducens MBEL55E
Position: -155
Score: 6.12521
Locus tag: MS0698
Name: oglP
Funciton: predicted oligogalacturonate TRAP transporter, substrate-binding subunit
Locus tag: MS0697
Name: oglQ
Funciton: predicted oligogalacturonate TRAP transporter, small transmembrane subunit
Locus tag: MS0696
Name: oglM
Funciton: predicted oligogalacturonate TRAP transporter, large transmembrane subunit
oglP-oglQ-oglM -155 6.1 AATTAAAATAATGTTTTATTT MS0698