Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing iscU gene

Properties
Regulog: IscR - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria
Built upon 41 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Oceanospirillum sp. MED92
Position: -68
Score: 5.36451
Sequence: TTAATTGACCTTTTTGGTCGGGTAT
Locus tag: MED92_00535
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: MED92_00540
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: MED92_00545
Name: iscU
Funciton: Iron-sulfur cluster assembly scaffold protein IscU
Locus tag: MED92_00550
Name: iscA
Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
Locus tag: MED92_00555
Name: hscB
Funciton: Chaperone protein HscB
Locus tag: MED92_00560
Name: hscA
Funciton: Chaperone protein HscA
Locus tag: MED92_00565
Name: fdx
Funciton: ferredoxin, 2Fe-2S type, ISC system
iscR-iscS-iscU-iscA-hscB-hscA-fdx -68 5.4 TTAATTGACCTTTTTGGTCGGGTAT MED92_00535